Transcript: Human NM_001261403.3

Homo sapiens nuclear factor kappa B subunit 2 (NFKB2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
NFKB2 (4791)
Length:
3103
CDS:
256..2955

Additional Resources:

NCBI RefSeq record:
NM_001261403.3
NBCI Gene record:
NFKB2 (4791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356047 ACATTGAGGTTCGGTTCTATG pLKO_005 1025 CDS 100% 10.800 15.120 N NFKB2 n/a
2 TRCN0000360444 ACATTGAGGTTCGGTTCTATG pLKO_005 1025 CDS 100% 10.800 15.120 N Nfkb2 n/a
3 TRCN0000006513 CGATTTCGATATGGCTGTGAA pLKO.1 409 CDS 100% 4.950 6.930 N NFKB2 n/a
4 TRCN0000355953 TCATTGAGCAGATAGTCTATG pLKO_005 1763 CDS 100% 10.800 8.640 N NFKB2 n/a
5 TRCN0000355955 GGACATGACTGCCCAATTTAA pLKO_005 636 CDS 100% 15.000 10.500 N NFKB2 n/a
6 TRCN0000356005 TCCAAACAGTTCACCTATTAC pLKO_005 1213 CDS 100% 13.200 9.240 N NFKB2 n/a
7 TRCN0000006514 CCCTATCACAAGATGAAGATT pLKO.1 1132 CDS 100% 5.625 3.938 N NFKB2 n/a
8 TRCN0000006512 GCTGCTAAATGCTGCTCAGAA pLKO.1 2490 CDS 100% 4.950 3.465 N NFKB2 n/a
9 TRCN0000006515 CCTGTAACAGTGTTTCTGCAA pLKO.1 1159 CDS 100% 2.640 1.848 N NFKB2 n/a
10 TRCN0000006516 GCCCAATTTAACAACCTGGGT pLKO.1 646 CDS 100% 0.660 0.462 N NFKB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261403.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.