Transcript: Human NM_001264573.2

Homo sapiens kinesin family member 18B (KIF18B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
KIF18B (146909)
Length:
4351
CDS:
161..2662

Additional Resources:

NCBI RefSeq record:
NM_001264573.2
NBCI Gene record:
KIF18B (146909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001264573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245671 ACGTACAACACCCTCAAATAT pLKO_005 1172 CDS 100% 15.000 21.000 N KIF18B n/a
2 TRCN0000245672 TCTAAGCAGTTGGCCCTAAAG pLKO_005 1706 CDS 100% 10.800 15.120 N KIF18B n/a
3 TRCN0000245673 CAGCTACCAGGAGGTGTATAA pLKO_005 619 CDS 100% 13.200 9.240 N KIF18B n/a
4 TRCN0000245670 ATGCCATCTTCCAGATCTTTG pLKO_005 834 CDS 100% 10.800 7.560 N KIF18B n/a
5 TRCN0000245674 TTGTCTTTGACCGGGTCTTTG pLKO_005 369 CDS 100% 10.800 7.560 N KIF18B n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3851 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3722 3UTR 100% 2.640 1.320 Y LINC01098 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3851 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001264573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.