Transcript: Human NM_001267560.2

Homo sapiens tight junction protein 3 (TJP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TJP3 (27134)
Length:
3076
CDS:
188..2947

Additional Resources:

NCBI RefSeq record:
NM_001267560.2
NBCI Gene record:
TJP3 (27134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108428 GCGCCTCAACTATGTGCAGTA pLKO.1 2239 CDS 100% 4.050 5.670 N TJP3 n/a
2 TRCN0000444237 GGCAGTTCCTGGTGAACATTC pLKO_005 1005 CDS 100% 10.800 7.560 N TJP3 n/a
3 TRCN0000108425 CGACATTGCTATGCAGAAGTT pLKO.1 2071 CDS 100% 4.950 3.465 N TJP3 n/a
4 TRCN0000108427 GAGAAGTCAGAAGGGAAGCTA pLKO.1 959 CDS 100% 3.000 2.100 N TJP3 n/a
5 TRCN0000108429 GATACTCAAGACCTGCACCAA pLKO.1 415 CDS 100% 2.640 1.848 N TJP3 n/a
6 TRCN0000108426 GATTGAGAAGTCAGAAGGGAA pLKO.1 955 CDS 100% 2.640 1.848 N TJP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.