Transcript: Human NM_001267866.2

Homo sapiens chromosome 7 open reading frame 57 (C7orf57), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C7orf57 (136288)
Length:
1886
CDS:
400..861

Additional Resources:

NCBI RefSeq record:
NM_001267866.2
NBCI Gene record:
C7orf57 (136288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127830 GATCAAGCCAATGGTAGCTAT pLKO.1 436 CDS 100% 4.950 6.930 N C7orf57 n/a
2 TRCN0000440005 TGCCGGATTACATGGTTCATG pLKO_005 401 CDS 100% 4.950 6.930 N C7orf57 n/a
3 TRCN0000131240 GATTGGTATTACCACGTCCCA pLKO.1 88 5UTR 100% 0.660 0.924 N C7orf57 n/a
4 TRCN0000417474 GAATATGGTGATACAGTTTAT pLKO_005 1302 3UTR 100% 13.200 10.560 N C7orf57 n/a
5 TRCN0000271068 TCCCTGCCAGACTGGTATATT pLKO_005 328 5UTR 100% 15.000 10.500 N Gm11992 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267866.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.