Transcript: Human NM_001270679.1

Homo sapiens mitochondrial calcium uniporter (MCU), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MCU (90550)
Length:
2899
CDS:
22..1014

Additional Resources:

NCBI RefSeq record:
NM_001270679.1
NBCI Gene record:
MCU (90550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133984 CAATCAACTCAAGGATGCAAT pLKO.1 909 CDS 100% 4.950 3.960 N MCU n/a
2 TRCN0000435867 ATCAGGCATTGTGGAATATAA pLKO_005 1184 3UTR 100% 15.000 10.500 N MCU n/a
3 TRCN0000420533 TCAAAGGGCTTAGTGAATATT pLKO_005 1207 3UTR 100% 15.000 10.500 N MCU n/a
4 TRCN0000138929 GATCGCTTCCTGGCAGAATTT pLKO.1 183 CDS 100% 13.200 9.240 N MCU n/a
5 TRCN0000135430 GCCATGGCAATGTATGCATAT pLKO.1 781 CDS 100% 10.800 7.560 N MCU n/a
6 TRCN0000133861 GCAAGGAGTTTCTTTCTCTTT pLKO.1 2376 3UTR 100% 4.950 3.465 N MCU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.