Transcript: Human NM_001270895.1

Homo sapiens trafficking protein particle complex 3 (TRAPPC3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
TRAPPC3 (27095)
Length:
1326
CDS:
268..672

Additional Resources:

NCBI RefSeq record:
NM_001270895.1
NBCI Gene record:
TRAPPC3 (27095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059565 GCATCACTCCAAGCATTACTA pLKO.1 392 CDS 100% 5.625 7.875 N TRAPPC3 n/a
2 TRCN0000291612 GCATCACTCCAAGCATTACTA pLKO_005 392 CDS 100% 5.625 7.875 N TRAPPC3 n/a
3 TRCN0000059566 GATGAGATTCATCAGGCGGAT pLKO.1 621 CDS 100% 2.160 3.024 N TRAPPC3 n/a
4 TRCN0000291613 GATGAGATTCATCAGGCGGAT pLKO_005 621 CDS 100% 2.160 3.024 N TRAPPC3 n/a
5 TRCN0000059564 CCGGCTGATTGAAGATTTCTT pLKO.1 288 CDS 100% 5.625 3.938 N TRAPPC3 n/a
6 TRCN0000291611 CCGGCTGATTGAAGATTTCTT pLKO_005 288 CDS 100% 5.625 3.938 N TRAPPC3 n/a
7 TRCN0000059567 CCAGCTATGTAAGGACTATGA pLKO.1 213 5UTR 100% 4.950 3.465 N TRAPPC3 n/a
8 TRCN0000291610 CCAGCTATGTAAGGACTATGA pLKO_005 213 5UTR 100% 4.950 3.465 N TRAPPC3 n/a
9 TRCN0000059563 CCTGATAACCACTCATCCCTT pLKO.1 484 CDS 100% 2.640 1.848 N TRAPPC3 n/a
10 TRCN0000291555 CCTGATAACCACTCATCCCTT pLKO_005 484 CDS 100% 2.640 1.848 N TRAPPC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.