Transcript: Mouse NM_001271353.1

Mus musculus cystathionine beta-synthase (Cbs), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Cbs (12411)
Length:
2458
CDS:
248..1891

Additional Resources:

NCBI RefSeq record:
NM_001271353.1
NBCI Gene record:
Cbs (12411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423698 GTCCACGAGCAGATCCAATAC pLKO_005 1769 CDS 100% 10.800 15.120 N Cbs n/a
2 TRCN0000437720 TGAAGGGCTATCGCTGCATTA pLKO_005 717 CDS 100% 10.800 15.120 N Cbs n/a
3 TRCN0000075998 GCTACCTAAATGAATCCTCTA pLKO.1 2014 3UTR 100% 4.050 5.670 N Cbs n/a
4 TRCN0000431116 ATCACAGGGATCGCCAGAAAG pLKO_005 1019 CDS 100% 10.800 8.640 N Cbs n/a
5 TRCN0000076000 CCATCAGACGAAGTCTGCAAA pLKO.1 1658 CDS 100% 4.950 3.960 N Cbs n/a
6 TRCN0000435178 TGTGACGGGAAGCTGGATATG pLKO_005 968 CDS 100% 10.800 7.560 N Cbs n/a
7 TRCN0000075999 CCCTATGGTCAGAATCAACAA pLKO.1 499 CDS 100% 4.950 3.465 N Cbs n/a
8 TRCN0000076002 ACACTATCATTGAGCCAACTT pLKO.1 657 CDS 100% 4.950 2.970 N Cbs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.