Transcript: Mouse NM_001271402.1

Mus musculus epoxide hydrolase 2, cytoplasmic (Ephx2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ephx2 (13850)
Length:
2142
CDS:
327..1832

Additional Resources:

NCBI RefSeq record:
NM_001271402.1
NBCI Gene record:
Ephx2 (13850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032708 CAACACTTTGACTTCCTGATA pLKO.1 600 CDS 100% 4.950 3.465 N Ephx2 n/a
2 TRCN0000032706 CCATGAAAGTTATCCGATCTA pLKO.1 1273 CDS 100% 4.950 3.465 N Ephx2 n/a
3 TRCN0000032704 CCGTCCTGAAATGTCCAAGAA pLKO.1 1661 CDS 100% 4.950 3.465 N Ephx2 n/a
4 TRCN0000032705 GCTGTGCATAAAGCCACTGAA pLKO.1 1416 CDS 100% 4.950 3.465 N Ephx2 n/a
5 TRCN0000032707 GAGCCAATCTACCTGAGAATT pLKO.1 403 CDS 100% 0.000 0.000 N Ephx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.