Transcript: Mouse NM_001271627.1

Mus musculus runt related transcription factor 2 (Runx2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Runx2 (12393)
Length:
5904
CDS:
402..1988

Additional Resources:

NCBI RefSeq record:
NM_001271627.1
NBCI Gene record:
Runx2 (12393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095591 CCCAGGCGTATTTCAGATGAT pLKO.1 1428 CDS 100% 4.950 6.930 N Runx2 n/a
2 TRCN0000013654 CTCAGTGATTTAGGGCGCATT pLKO.1 1158 CDS 100% 4.050 5.670 N RUNX2 n/a
3 TRCN0000095590 GCACGCTATTAAATCCAAATT pLKO.1 1861 CDS 100% 13.200 10.560 N Runx2 n/a
4 TRCN0000013655 CAGCACTCCATATCTCTACTA pLKO.1 1742 CDS 100% 4.950 3.960 N RUNX2 n/a
5 TRCN0000095592 GCAGAATGGATGAGTCTGTTT pLKO.1 1954 CDS 100% 4.950 3.960 N Runx2 n/a
6 TRCN0000427338 ACTTGCTGCAGGTACTCATTT pLKO_005 2476 3UTR 100% 13.200 9.240 N Runx2 n/a
7 TRCN0000415892 AGGTTCAACGATCTGAGATTT pLKO_005 963 CDS 100% 13.200 9.240 N RUNX2 n/a
8 TRCN0000434163 CAAATTTGCCTAACCAGAATG pLKO_005 1876 CDS 100% 10.800 7.560 N RUNX2 n/a
9 TRCN0000421148 GAGTTTCACCTTGACCATAAC pLKO_005 1007 CDS 100% 10.800 7.560 N Runx2 n/a
10 TRCN0000095589 CGGTTCTCAAAGGAGCACAAA pLKO.1 4962 3UTR 100% 4.950 3.465 N Runx2 n/a
11 TRCN0000013656 GTGGTCCTATGACCAGTCTTA pLKO.1 1310 CDS 100% 0.495 0.297 N RUNX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.