Transcript: Human NM_001271640.2

Homo sapiens zinc finger protein 138 (ZNF138), transcript variant 9, mRNA.

Source:
NCBI, updated 2018-12-08
Taxon:
Homo sapiens (human)
Gene:
ZNF138 (7697)
Length:
2638
CDS:
142..444

Additional Resources:

NCBI RefSeq record:
NM_001271640.2
NBCI Gene record:
ZNF138 (7697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429634 TAACAACTTACTGAACATAAG pLKO_005 1158 3UTR 100% 10.800 7.560 N ZNF138 n/a
2 TRCN0000012919 CTGGTCCACAAACCTTTCTAA pLKO.1 815 3UTR 100% 5.625 3.938 N ZNF138 n/a
3 TRCN0000012922 CACAAACCTTTCTAAACCTAA pLKO.1 821 3UTR 100% 4.950 3.465 N ZNF138 n/a
4 TRCN0000414608 GCGGAATGTATATAGGCATGT pLKO_005 216 CDS 100% 4.050 2.835 N ZNF138 n/a
5 TRCN0000421902 ACAATGTGGCAAGGTCTTTAA pLKO_005 1046 3UTR 100% 13.200 7.920 N ZNF138 n/a
6 TRCN0000434325 ACACTGTGGCAAAGCCTTTAA pLKO_005 962 3UTR 100% 13.200 7.920 N ZNF138 n/a
7 TRCN0000424428 ACCTTACTAGACATAAGATAA pLKO_005 994 3UTR 100% 13.200 7.920 N ZNF138 n/a
8 TRCN0000413885 AGCTCACTGAACATAAGTTAA pLKO_005 1330 3UTR 100% 13.200 7.920 N ZNF138 n/a
9 TRCN0000417549 CAATCCTCAATCCTTACTAAA pLKO_005 900 3UTR 100% 13.200 7.920 N ZNF138 n/a
10 TRCN0000012920 CCCTTACTAAACATCAGATAA pLKO.1 1078 3UTR 100% 13.200 7.920 N ZNF138 n/a
11 TRCN0000422662 TTCACGCCTAACTCAACATAA pLKO_005 737 3UTR 100% 13.200 7.920 N ZNF138 n/a
12 TRCN0000420316 AGAATGTGACAAATCACTTTG pLKO_005 710 3UTR 100% 10.800 6.480 N ZNF138 n/a
13 TRCN0000012918 CCTCAACTCTTATTACACATA pLKO.1 1492 3UTR 100% 4.950 2.970 N ZNF138 n/a
14 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1021 3UTR 100% 13.200 6.600 Y ZNF138 n/a
15 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2406 3UTR 100% 5.625 2.813 Y ZNF254 n/a
16 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 988 3UTR 100% 4.950 2.475 Y ZNF681 n/a
17 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 237 CDS 100% 4.950 2.475 Y ZNF493 n/a
18 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1698 3UTR 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.