Transcript: Mouse NM_001271676.1

Mus musculus interferon gamma inducible protein 47 (Ifi47), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ifi47 (15953)
Length:
1937
CDS:
358..1620

Additional Resources:

NCBI RefSeq record:
NM_001271676.1
NBCI Gene record:
Ifi47 (15953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102778 GCTTGGATGATCAATCGATTA pLKO.1 1334 CDS 100% 10.800 15.120 N Ifi47 n/a
2 TRCN0000312218 GCTTGGATGATCAATCGATTA pLKO_005 1334 CDS 100% 10.800 15.120 N Ifi47 n/a
3 TRCN0000102779 CTTGTAAAGGATAACAGCATA pLKO.1 1429 CDS 100% 4.950 6.930 N Ifi47 n/a
4 TRCN0000102777 GCCTCAGTACTCTGCATTAAT pLKO.1 432 CDS 100% 15.000 10.500 N Ifi47 n/a
5 TRCN0000349380 GCCTCAGTACTCTGCATTAAT pLKO_005 432 CDS 100% 15.000 10.500 N Ifi47 n/a
6 TRCN0000102775 CCTAAGCTCCACAGAAGTGTA pLKO.1 1707 3UTR 100% 4.950 3.465 N Ifi47 n/a
7 TRCN0000312219 CCTAAGCTCCACAGAAGTGTA pLKO_005 1707 3UTR 100% 4.950 3.465 N Ifi47 n/a
8 TRCN0000102776 GCTTCCATTGAGCTAAAGAAA pLKO.1 1177 CDS 100% 5.625 3.375 N Ifi47 n/a
9 TRCN0000312263 GCTTCCATTGAGCTAAAGAAA pLKO_005 1177 CDS 100% 5.625 3.375 N Ifi47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.