Transcript: Human NM_001271754.2

Homo sapiens integrin subunit beta like 1 (ITGBL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ITGBL1 (9358)
Length:
4800
CDS:
365..1426

Additional Resources:

NCBI RefSeq record:
NM_001271754.2
NBCI Gene record:
ITGBL1 (9358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142161 GAGCTGTCTATGACCGATATT pLKO.1 771 CDS 100% 13.200 18.480 N ITGBL1 n/a
2 TRCN0000139217 CGGAAGTGTAACATGACGGAA pLKO.1 1145 CDS 100% 2.640 3.696 N ITGBL1 n/a
3 TRCN0000142118 GTACCCAACTAACTGTGACTT pLKO.1 322 5UTR 100% 0.000 0.000 N ITGBL1 n/a
4 TRCN0000144933 GAGAATGCATAGACGATGAAA pLKO.1 489 CDS 100% 5.625 4.500 N ITGBL1 n/a
5 TRCN0000145566 GCAGGTGTAAGTGTGATAATT pLKO.1 420 CDS 100% 15.000 10.500 N ITGBL1 n/a
6 TRCN0000141863 GCTGTCTATGACCGATATTCT pLKO.1 773 CDS 100% 5.625 3.938 N ITGBL1 n/a
7 TRCN0000144790 GACAAACATGATGGTCTCATT pLKO.1 1307 CDS 100% 4.950 3.465 N ITGBL1 n/a
8 TRCN0000139491 GATGACAGAGACTGCGACAAA pLKO.1 1292 CDS 100% 4.950 3.465 N ITGBL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.