Transcript: Human NM_001271756.1

Homo sapiens integrin subunit beta like 1 (ITGBL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ITGBL1 (9358)
Length:
2027
CDS:
13..1218

Additional Resources:

NCBI RefSeq record:
NM_001271756.1
NBCI Gene record:
ITGBL1 (9358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142161 GAGCTGTCTATGACCGATATT pLKO.1 563 CDS 100% 13.200 18.480 N ITGBL1 n/a
2 TRCN0000142325 CGAATGAAATCCGAGTACCTA pLKO.1 1351 3UTR 100% 3.000 4.200 N ITGBL1 n/a
3 TRCN0000139217 CGGAAGTGTAACATGACGGAA pLKO.1 937 CDS 100% 2.640 3.696 N ITGBL1 n/a
4 TRCN0000142118 GTACCCAACTAACTGTGACTT pLKO.1 114 CDS 100% 0.000 0.000 N ITGBL1 n/a
5 TRCN0000144933 GAGAATGCATAGACGATGAAA pLKO.1 281 CDS 100% 5.625 4.500 N ITGBL1 n/a
6 TRCN0000145566 GCAGGTGTAAGTGTGATAATT pLKO.1 212 CDS 100% 15.000 10.500 N ITGBL1 n/a
7 TRCN0000141863 GCTGTCTATGACCGATATTCT pLKO.1 565 CDS 100% 5.625 3.938 N ITGBL1 n/a
8 TRCN0000144790 GACAAACATGATGGTCTCATT pLKO.1 1099 CDS 100% 4.950 3.465 N ITGBL1 n/a
9 TRCN0000139491 GATGACAGAGACTGCGACAAA pLKO.1 1084 CDS 100% 4.950 3.465 N ITGBL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.