Transcript: Human NM_001271895.2

Homo sapiens threonyl-tRNA synthetase 2, mitochondrial (TARS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TARS2 (80222)
Length:
2481
CDS:
33..1943

Additional Resources:

NCBI RefSeq record:
NM_001271895.2
NBCI Gene record:
TARS2 (80222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045433 CGGACTATTAAGATATCACTT pLKO.1 207 CDS 100% 4.950 6.930 N TARS2 n/a
2 TRCN0000045434 CCTGAGATTTGACCTCCAGTA pLKO.1 1478 CDS 100% 4.050 5.670 N TARS2 n/a
3 TRCN0000286404 CCTGAGATTTGACCTCCAGTA pLKO_005 1478 CDS 100% 4.050 5.670 N TARS2 n/a
4 TRCN0000293777 CAGGCCGAACAGGTCCTTAAA pLKO_005 1314 CDS 100% 13.200 9.240 N TARS2 n/a
5 TRCN0000293776 GGTCCCAAATGCCGAAGAAAT pLKO_005 1916 CDS 100% 13.200 9.240 N TARS2 n/a
6 TRCN0000045436 CCAAGTACAGAATATGGCTTT pLKO.1 495 CDS 100% 4.050 2.835 N TARS2 n/a
7 TRCN0000286403 CCAAGTACAGAATATGGCTTT pLKO_005 495 CDS 100% 4.050 2.835 N TARS2 n/a
8 TRCN0000293778 TTTGTACATAGATGAGGCAAA pLKO_005 1947 3UTR 100% 4.050 2.835 N TARS2 n/a
9 TRCN0000045437 GCTGTCTTGATTTCCTCCGTT pLKO.1 1207 CDS 100% 2.640 1.848 N TARS2 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2352 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.