Transcript: Human NM_001271927.2

Homo sapiens kinesin family member 27 (KIF27), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
KIF27 (55582)
Length:
7171
CDS:
262..4269

Additional Resources:

NCBI RefSeq record:
NM_001271927.2
NBCI Gene record:
KIF27 (55582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116653 CGGTTCAAAGAATCCATTCAA pLKO.1 1039 CDS 100% 5.625 7.875 N KIF27 n/a
2 TRCN0000116656 GAACGGTTCAAAGAATCCATT pLKO.1 1036 CDS 100% 4.950 6.930 N KIF27 n/a
3 TRCN0000417814 AGTTCTGGAACGGGATAATAT pLKO_005 3483 CDS 100% 15.000 10.500 N KIF27 n/a
4 TRCN0000454988 AGTCGACTGTCATCCCAAATT pLKO_005 4066 CDS 100% 13.200 9.240 N KIF27 n/a
5 TRCN0000116654 CCTCACCTCATTTCGAGGAAT pLKO.1 1620 CDS 100% 4.950 3.465 N KIF27 n/a
6 TRCN0000116652 GCTCAAGTTCACTACCTCTTT pLKO.1 4338 3UTR 100% 4.950 3.465 N KIF27 n/a
7 TRCN0000116655 CCCTTGTTGAATTGAGTGATA pLKO.1 2285 CDS 100% 4.950 2.475 Y KIF27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.