Transcript: Human NM_001271996.2

Homo sapiens cAMP responsive element binding protein 3 like 3 (CREB3L3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
CREB3L3 (84699)
Length:
2582
CDS:
118..1497

Additional Resources:

NCBI RefSeq record:
NM_001271996.2
NBCI Gene record:
CREB3L3 (84699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423308 ACAAGCAGTCGGCGCAAGAAA pLKO_005 869 CDS 100% 5.625 7.875 N CREB3L3 n/a
2 TRCN0000016649 CCTATCATCCTGGCAACTCTT pLKO.1 491 CDS 100% 4.950 6.930 N CREB3L3 n/a
3 TRCN0000016648 CGATGCAATCTCACCGTGAAA pLKO.1 640 CDS 100% 4.950 6.930 N CREB3L3 n/a
4 TRCN0000412773 AGCTCCTGGATCTCCTGTTTG pLKO_005 188 CDS 100% 10.800 7.560 N CREB3L3 n/a
5 TRCN0000016650 GCAGTCCTGTTGCTGTCCTTT pLKO.1 1084 CDS 100% 4.950 3.465 N CREB3L3 n/a
6 TRCN0000016651 TCCAGAACTTTGCACAACGAT pLKO.1 1189 CDS 100% 3.000 2.100 N CREB3L3 n/a
7 TRCN0000016652 CCAGTGATCCAAGTACCTGAA pLKO.1 532 CDS 100% 4.050 2.430 N CREB3L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.