Transcript: Human NM_001272038.1

Homo sapiens RAB13, member RAS oncogene family (RAB13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
RAB13 (5872)
Length:
1353
CDS:
503..871

Additional Resources:

NCBI RefSeq record:
NM_001272038.1
NBCI Gene record:
RAB13 (5872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343560 CATGGGCATTATCCTAGTATA pLKO_005 502 5UTR 100% 13.200 18.480 N RAB13 n/a
2 TRCN0000048118 CGAGAGCATGGAATCCGATTT pLKO.1 680 CDS 100% 10.800 15.120 N RAB13 n/a
3 TRCN0000343509 GTCACATAGGTAGATGGTAAA pLKO_005 967 3UTR 100% 10.800 15.120 N RAB13 n/a
4 TRCN0000048122 CGAGAATATTCAGAACTGGAT pLKO.1 547 CDS 100% 2.640 3.696 N RAB13 n/a
5 TRCN0000380598 GTGCTAAATCCAGTATGAATG pLKO_005 711 CDS 100% 10.800 8.640 N RAB13 n/a
6 TRCN0000382005 AGAAGGAGCAGGCCGATAAGT pLKO_005 654 CDS 100% 5.625 4.500 N RAB13 n/a
7 TRCN0000048121 GACAATAACTACTGCCTACTA pLKO.1 472 5UTR 100% 4.950 3.960 N RAB13 n/a
8 TRCN0000352881 AGATCCGCACTGTGGATATAG pLKO_005 396 5UTR 100% 13.200 9.240 N RAB13 n/a
9 TRCN0000343510 ATGAGAAATCTTTCGAGAATA pLKO_005 534 CDS 100% 13.200 9.240 N RAB13 n/a
10 TRCN0000048119 CCATGGGCATTATCCTAGTAT pLKO.1 501 5UTR 100% 5.625 3.938 N RAB13 n/a
11 TRCN0000381900 GAGATCAGGAAACGGCAACAA pLKO_005 787 CDS 100% 4.950 3.465 N RAB13 n/a
12 TRCN0000379551 TCGAGAGCATGGAATCCGATT pLKO_005 679 CDS 100% 4.050 2.835 N RAB13 n/a
13 TRCN0000381528 AGAGCGGTTCAAGACAATAAC pLKO_005 460 5UTR 100% 13.200 7.920 N RAB13 n/a
14 TRCN0000381967 AGAAGGCAAGGAGGTAGGAAG pLKO_005 1084 3UTR 100% 4.050 2.430 N RAB13 n/a
15 TRCN0000381143 CAAGAAGAACACCAACAAGTG pLKO_005 838 CDS 100% 4.050 2.430 N RAB13 n/a
16 TRCN0000382303 GAAGATCAAACTACAAGTCTG pLKO_005 424 5UTR 100% 4.050 2.430 N RAB13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272038.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.