Transcript: Human NM_001272088.2

Homo sapiens solute carrier family 1 member 6 (SLC1A6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SLC1A6 (6511)
Length:
1981
CDS:
360..1298

Additional Resources:

NCBI RefSeq record:
NM_001272088.2
NBCI Gene record:
SLC1A6 (6511)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430836 ATGCTGGTGTTACCTCTCATT pLKO_005 663 CDS 100% 4.950 3.465 N SLC1A6 n/a
2 TRCN0000043556 CAGAAATATGTTTCCACCAAA pLKO.1 905 CDS 100% 4.950 3.465 N SLC1A6 n/a
3 TRCN0000043553 CCAGATCAAGTACTTCTCTTT pLKO.1 611 CDS 100% 4.950 3.465 N SLC1A6 n/a
4 TRCN0000043554 CAGCCTCAATGAGGCTATTAT pLKO.1 1250 CDS 100% 1.500 1.050 N SLC1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.