Transcript: Human NM_001276276.2

Homo sapiens MYC associated zinc finger protein (MAZ), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
MAZ (4150)
Length:
1625
CDS:
174..692

Additional Resources:

NCBI RefSeq record:
NM_001276276.2
NBCI Gene record:
MAZ (4150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235699 GATGCTGAGCTCGGCTTATAT pLKO_005 455 CDS 100% 15.000 21.000 N MAZ n/a
2 TRCN0000238893 GATGCTGAGCTCGGCTTATAT pLKO_005 455 CDS 100% 15.000 21.000 N Maz n/a
3 TRCN0000235703 TCTGTGAGCTCTGCAACAAAG pLKO_005 517 CDS 100% 10.800 15.120 N MAZ n/a
4 TRCN0000238895 TCTGTGAGCTCTGCAACAAAG pLKO_005 517 CDS 100% 10.800 15.120 N Maz n/a
5 TRCN0000015347 CGGCTTATATTTCGGACCACA pLKO.1 466 CDS 100% 2.640 3.696 N MAZ n/a
6 TRCN0000015343 CTCCAAGTTGGTTGCGGGGGA pLKO.1 694 3UTR 100% 0.000 0.000 N MAZ n/a
7 TRCN0000015346 GAGGCCATGTTCCCGGTGTTT pLKO.1 168 5UTR 100% 1.650 1.155 N MAZ n/a
8 TRCN0000235700 TTTCCCACCAACTCCTATTTC pLKO_005 765 3UTR 100% 13.200 7.920 N MAZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.