Transcript: Mouse NM_001276298.1

Mus musculus arginine vasopressin receptor 2 (Avpr2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Avpr2 (12000)
Length:
1721
CDS:
143..1147

Additional Resources:

NCBI RefSeq record:
NM_001276298.1
NBCI Gene record:
Avpr2 (12000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027365 GCACGTCTTCATCAGTCATTT pLKO.1 361 CDS 100% 13.200 10.560 N Avpr2 n/a
2 TRCN0000027374 CTGGCCCTGCTATCTACAATT pLKO.1 260 CDS 100% 13.200 9.240 N Avpr2 n/a
3 TRCN0000027376 GCTCAACGTGATGTGGGAAAT pLKO.1 674 CDS 100% 10.800 7.560 N Avpr2 n/a
4 TRCN0000027345 GTATGCCTCTTCCTACATGAT pLKO.1 508 CDS 100% 4.950 3.465 N Avpr2 n/a
5 TRCN0000027400 GTTCTTATCTTCCGGGAGATA pLKO.1 815 CDS 100% 0.495 0.347 N Avpr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.