Transcript: Human NM_001276385.2

Homo sapiens interactor of little elongation complex ELL subunit 2 (ICE2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ICE2 (79664)
Length:
3865
CDS:
233..1384

Additional Resources:

NCBI RefSeq record:
NM_001276385.2
NBCI Gene record:
ICE2 (79664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153903 CCAACAGACGTATAGGAGAAA pLKO.1 372 CDS 100% 4.950 3.465 N ICE2 n/a
2 TRCN0000152747 GCTACCATTGAAACGTCAGAA pLKO.1 971 CDS 100% 4.950 3.465 N ICE2 n/a
3 TRCN0000150652 GCTTGCATTGAACAAGTGAAA pLKO.1 773 CDS 100% 4.950 3.465 N ICE2 n/a
4 TRCN0000156804 GCAGAGGAGTTATGTGGACTT pLKO.1 544 CDS 100% 4.050 2.835 N ICE2 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1969 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1969 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.