Transcript: Human NM_001277115.2

Homo sapiens dynein axonemal heavy chain 11 (DNAH11), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DNAH11 (8701)
Length:
14343
CDS:
208..13758

Additional Resources:

NCBI RefSeq record:
NM_001277115.2
NBCI Gene record:
DNAH11 (8701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424163 ATAGTCCTGGATGGCGATATT pLKO_005 6973 CDS 100% 13.200 18.480 N DNAH11 n/a
2 TRCN0000082998 CCTCACTATAAGCCGGAATTA pLKO.1 10975 CDS 100% 13.200 18.480 N DNAH11 n/a
3 TRCN0000436041 TGAGCTTGTTAACCATAATTA pLKO_005 3560 CDS 100% 15.000 10.500 N DNAH11 n/a
4 TRCN0000083000 CCCTGCTACAAGATCAGATTT pLKO.1 7457 CDS 100% 13.200 9.240 N DNAH11 n/a
5 TRCN0000083002 GCCACAGAGATTACAGGGTTT pLKO.1 12242 CDS 100% 4.050 2.835 N DNAH11 n/a
6 TRCN0000083001 CCAGGCTTTCTCTTTGTGAAA pLKO.1 5021 CDS 100% 4.950 2.970 N DNAH11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.