Transcript: Human NM_001277842.2

Homo sapiens cyclin T1 (CCNT1), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CCNT1 (904)
Length:
6624
CDS:
33..587

Additional Resources:

NCBI RefSeq record:
NM_001277842.2
NBCI Gene record:
CCNT1 (904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013673 GCCTTGTTTCTAGCAGCTAAA pLKO.1 291 CDS 100% 10.800 15.120 N CCNT1 n/a
2 TRCN0000273897 TACTAGAAGTGAGGCTTATTT pLKO_005 392 CDS 100% 15.000 10.500 N CCNT1 n/a
3 TRCN0000273836 AGATTGCCAAGAGTACTAAAT pLKO_005 1637 3UTR 100% 13.200 9.240 N CCNT1 n/a
4 TRCN0000374970 AGATTGCCAAGAGTACTAAAT pLKO_005 1637 3UTR 100% 13.200 9.240 N Ccnt1 n/a
5 TRCN0000013674 GCCAATGTGAAGTCACAATAT pLKO.1 1102 3UTR 100% 13.200 9.240 N CCNT1 n/a
6 TRCN0000273835 GCCAATGTGAAGTCACAATAT pLKO_005 1102 3UTR 100% 13.200 9.240 N CCNT1 n/a
7 TRCN0000273837 TTAGGCTTTGAACTAACAATT pLKO_005 462 CDS 100% 13.200 9.240 N CCNT1 n/a
8 TRCN0000013675 CCCACTGCATTTGAATTTGTT pLKO.1 1900 3UTR 100% 5.625 3.938 N CCNT1 n/a
9 TRCN0000013677 CGGTGGTATTTCACTCGAGAA pLKO.1 63 CDS 100% 0.000 0.000 N CCNT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.