Transcript: Mouse NM_001277928.1

Mus musculus laminin, beta 3 (Lamb3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lamb3 (16780)
Length:
4016
CDS:
142..3648

Additional Resources:

NCBI RefSeq record:
NM_001277928.1
NBCI Gene record:
Lamb3 (16780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083348 CCAACTTAACCTTATGGATTT pLKO.1 708 CDS 100% 10.800 15.120 N LAMB3 n/a
2 TRCN0000055398 CCGAAGCAAGAAGGAGCAATT pLKO.1 2220 CDS 100% 10.800 7.560 N Lamb3 n/a
3 TRCN0000055401 GCTGCGCAAGATGAAAGAGAT pLKO.1 2913 CDS 100% 4.950 3.465 N Lamb3 n/a
4 TRCN0000055400 GCATGTTGATTGAGCGCTCTT pLKO.1 530 CDS 100% 4.050 2.835 N Lamb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.