Transcript: Mouse NM_001277989.2

Mus musculus Meis homeobox 3 (Meis3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Meis3 (17537)
Length:
1740
CDS:
162..1247

Additional Resources:

NCBI RefSeq record:
NM_001277989.2
NBCI Gene record:
Meis3 (17537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312776 AGGAGAGTGGCATTACCTATA pLKO_005 1226 CDS 100% 10.800 8.640 N Meis3 n/a
2 TRCN0000085826 AGACCAGAATACTACATGGAT pLKO.1 710 CDS 100% 3.000 2.400 N Meis3 n/a
3 TRCN0000312773 ACTCCTTCAATGAGGATATTG pLKO_005 478 CDS 100% 13.200 9.240 N Meis3 n/a
4 TRCN0000312774 CCACCAGCCTTGCACCTAATT pLKO_005 1296 3UTR 100% 13.200 9.240 N Meis3 n/a
5 TRCN0000312775 GTCAGGACACCAGGATCAATG pLKO_005 1185 CDS 100% 10.800 7.560 N Meis3 n/a
6 TRCN0000085825 ACTTAGAAGGAGAGTGGCATT pLKO.1 1219 CDS 100% 4.050 2.835 N Meis3 n/a
7 TRCN0000085824 CCCATGATTGACCAGTCTAAT pLKO.1 1086 CDS 100% 13.200 7.920 N Meis3 n/a
8 TRCN0000085823 GCAAAGACAAAGCCTCCAGTT pLKO.1 1439 3UTR 100% 4.050 2.835 N Meis3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.