Transcript: Human NM_001278138.1

Homo sapiens endoglin (ENG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ENG (2022)
Length:
2817
CDS:
705..2135

Additional Resources:

NCBI RefSeq record:
NM_001278138.1
NBCI Gene record:
ENG (2022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083141 GCAGGTGTCAGCAAGTATGAT pLKO.1 1400 CDS 100% 5.625 7.875 N ENG n/a
2 TRCN0000290311 GCAGGTGTCAGCAAGTATGAT pLKO_005 1400 CDS 100% 5.625 7.875 N ENG n/a
3 TRCN0000083139 GCGAGGTGACATATACCACTA pLKO.1 277 5UTR 100% 4.050 3.240 N ENG n/a
4 TRCN0000290381 GCGAGGTGACATATACCACTA pLKO_005 277 5UTR 100% 4.050 3.240 N ENG n/a
5 TRCN0000083140 CCACTTCTACACAGTACCCAT pLKO.1 1760 CDS 100% 2.640 2.112 N ENG n/a
6 TRCN0000290313 CCACTTCTACACAGTACCCAT pLKO_005 1760 CDS 100% 2.640 2.112 N ENG n/a
7 TRCN0000083142 GTCTTGCAGAAACAGTCCATT pLKO.1 226 5UTR 100% 4.950 3.465 N ENG n/a
8 TRCN0000307191 GTCTTGCAGAAACAGTCCATT pLKO_005 226 5UTR 100% 4.950 3.465 N ENG n/a
9 TRCN0000083138 CCCTGTCATTTGAACCTGGAT pLKO.1 2418 3UTR 100% 2.640 1.848 N ENG n/a
10 TRCN0000290312 CCCTGTCATTTGAACCTGGAT pLKO_005 2418 3UTR 100% 2.640 1.848 N ENG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.