Transcript: Human NM_001278307.1

Homo sapiens ubiquitin conjugating enzyme E2 F (putative) (UBE2F), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
UBE2F (140739)
Length:
2110
CDS:
205..666

Additional Resources:

NCBI RefSeq record:
NM_001278307.1
NBCI Gene record:
UBE2F (140739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034109 GCAATAAGATACCCGCTACAA pLKO.1 1074 3UTR 100% 4.950 6.930 N UBE2F n/a
2 TRCN0000435832 GATGACTACATCAAACGTTAT pLKO_005 637 CDS 100% 10.800 8.640 N UBE2F n/a
3 TRCN0000429893 TTCTGCACAAGCGATGCTAAT pLKO_005 1026 3UTR 100% 10.800 7.560 N UBE2F n/a
4 TRCN0000034111 CAAAGTGAAATGCCTGACCAA pLKO.1 396 CDS 100% 2.640 1.848 N UBE2F n/a
5 TRCN0000034113 CCAAAGTGAAATGCCTGACCA pLKO.1 395 CDS 100% 2.640 1.848 N UBE2F n/a
6 TRCN0000098571 GAGGGTTTCTGTGAGAGACAA pLKO.1 288 CDS 100% 4.950 2.475 Y Ube2f n/a
7 TRCN0000287774 GAGGGTTTCTGTGAGAGACAA pLKO_005 288 CDS 100% 4.950 2.475 Y Ube2f n/a
8 TRCN0000034110 CCCACAAGAACATTAAAGGAT pLKO.1 502 CDS 100% 3.000 1.500 Y UBE2F n/a
9 TRCN0000034112 CAGAACATCATTTGCGGGACA pLKO.1 593 CDS 100% 2.160 1.080 Y UBE2F n/a
10 TRCN0000098574 GAACATTCAATTGATGGCACT pLKO.1 472 CDS 100% 2.160 1.080 Y Ube2f n/a
11 TRCN0000287773 GAACATTCAATTGATGGCACT pLKO_005 472 CDS 100% 2.160 1.080 Y Ube2f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.