Transcript: Human NM_001278314.1

Homo sapiens INSC spindle orientation adaptor protein (INSC), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
INSC (387755)
Length:
2961
CDS:
74..1777

Additional Resources:

NCBI RefSeq record:
NM_001278314.1
NBCI Gene record:
INSC (387755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138732 CAGTTGAATGCCATCCGTGTT pLKO.1 1271 CDS 100% 4.050 5.670 N INSC n/a
2 TRCN0000137555 CGTTCTTTGACACAATGGCCT pLKO.1 1236 CDS 100% 0.660 0.924 N INSC n/a
3 TRCN0000138954 GAAGGAAATGGGCGAGATTGA pLKO.1 460 CDS 100% 4.950 3.960 N INSC n/a
4 TRCN0000220002 ATCCTCAGATGAGGCTTATTG pLKO.1 2520 3UTR 100% 13.200 9.240 N INSC n/a
5 TRCN0000136931 CGAGATTGAGAAGCTGCTAAT pLKO.1 472 CDS 100% 10.800 7.560 N INSC n/a
6 TRCN0000138788 GAGATGCTCCTGCAGTTGAAT pLKO.1 1259 CDS 100% 5.625 3.938 N INSC n/a
7 TRCN0000136771 CCTCTGACATCATTCAGGAAA pLKO.1 1392 CDS 100% 4.950 3.465 N INSC n/a
8 TRCN0000137242 GATTGTGACCATCTTGGCAAA pLKO.1 1348 CDS 100% 4.050 2.835 N INSC n/a
9 TRCN0000220003 TGGCCATAGTGGGAGTATTTA pLKO.1 2703 3UTR 100% 15.000 9.000 N INSC n/a
10 TRCN0000137204 GATGGAAGATCTGAAGCTCAT pLKO.1 166 CDS 100% 4.050 2.430 N INSC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.