Transcript: Human NM_001278438.1

Homo sapiens fibronectin type III domain containing 3A (FNDC3A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
FNDC3A (22862)
Length:
6346
CDS:
349..3945

Additional Resources:

NCBI RefSeq record:
NM_001278438.1
NBCI Gene record:
FNDC3A (22862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160207 CCTAGTGACAATGGTTCTAAA pLKO.1 1528 CDS 100% 13.200 18.480 N FNDC3A n/a
2 TRCN0000338613 TGAGACTATAGCACATCATTT pLKO_005 4049 3UTR 100% 13.200 18.480 N FNDC3A n/a
3 TRCN0000162491 CCAAAGACATTGTCAACCGAT pLKO.1 3274 CDS 100% 2.640 3.696 N FNDC3A n/a
4 TRCN0000350984 CCAAAGACATTGTCAACCGAT pLKO_005 3274 CDS 100% 2.640 3.696 N FNDC3A n/a
5 TRCN0000159160 GCATGTGGTTAATGTTGCATT pLKO.1 5088 3UTR 100% 4.950 3.960 N FNDC3A n/a
6 TRCN0000166534 CGTCTGGAATGTGTTGCCTTT pLKO.1 3214 CDS 100% 4.050 3.240 N FNDC3A n/a
7 TRCN0000338554 ATGAGTCAACATCCTATAAAT pLKO_005 3389 CDS 100% 15.000 10.500 N FNDC3A n/a
8 TRCN0000338553 TCACCAGCAACTACCTATTAT pLKO_005 2806 CDS 100% 15.000 10.500 N FNDC3A n/a
9 TRCN0000161468 GCCTGGTCTCAGTTATGAAAT pLKO.1 2775 CDS 100% 13.200 9.240 N FNDC3A n/a
10 TRCN0000159885 GCCTTTCTAAGTGGTAAGAAT pLKO.1 5562 3UTR 100% 5.625 3.938 N FNDC3A n/a
11 TRCN0000158910 CCACAGGTTATTGAAGACAAT pLKO.1 595 CDS 100% 4.950 3.465 N FNDC3A n/a
12 TRCN0000160265 CCAGTTATTTACAGTCTTCAA pLKO.1 3577 CDS 100% 4.950 3.465 N FNDC3A n/a
13 TRCN0000159674 GATCCAGTTATTTACAGTCTT pLKO.1 3574 CDS 100% 4.950 3.465 N FNDC3A n/a
14 TRCN0000158880 GTTATGAAGTTCTGATCTCAA pLKO.1 1268 CDS 100% 4.950 3.465 N FNDC3A n/a
15 TRCN0000350918 GTTATGAAGTTCTGATCTCAA pLKO_005 1268 CDS 100% 4.950 3.465 N FNDC3A n/a
16 TRCN0000160817 CCAGTAAACTTCAAGCTGCTT pLKO.1 5002 3UTR 100% 2.640 1.584 N FNDC3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.