Transcript: Human NM_001278453.2

Homo sapiens SP140 nuclear body protein (SP140), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SP140 (11262)
Length:
2902
CDS:
110..2371

Additional Resources:

NCBI RefSeq record:
NM_001278453.2
NBCI Gene record:
SP140 (11262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358617 CAGTGATGACTGTTCGGAAAT pLKO_005 931 CDS 100% 10.800 15.120 N SP140 n/a
2 TRCN0000358616 ATCCTGATTTAAACGAGATTT pLKO_005 477 CDS 100% 13.200 9.240 N SP140 n/a
3 TRCN0000378678 TCTAGCCTGCTATATGATAAT pLKO_005 1067 CDS 100% 13.200 9.240 N SP140 n/a
4 TRCN0000358619 AGACCCAGATTACTACCATAT pLKO_005 569 CDS 100% 10.800 7.560 N SP140 n/a
5 TRCN0000015963 CCCAAGTTACTGCCTTATGAT pLKO.1 815 CDS 100% 5.625 3.938 N SP140 n/a
6 TRCN0000015964 CCTCTCCAAATGAATAATGTA pLKO.1 533 CDS 100% 5.625 3.938 N SP140 n/a
7 TRCN0000015967 CCCAGTGACAAGAGTGATGTA pLKO.1 376 CDS 100% 4.950 3.465 N SP140 n/a
8 TRCN0000015965 GCAGCAAGGAATCTTGGTGAA pLKO.1 1585 CDS 100% 4.050 2.835 N SP140 n/a
9 TRCN0000015966 CGGAGCAATCAGCATATGAAA pLKO.1 1098 CDS 100% 0.000 0.000 N SP140 n/a
10 TRCN0000021961 GCTTCAAGAAAGCACAAAGAT pLKO.1 1487 CDS 100% 5.625 2.813 Y SP140L n/a
11 TRCN0000021960 CGACACTTGTTCAAGAGTCTT pLKO.1 1882 CDS 100% 4.950 2.475 Y SP140L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.