Transcript: Human NM_001278563.3

Homo sapiens collagen type XXVI alpha 1 chain (COL26A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COL26A1 (136227)
Length:
2978
CDS:
159..1484

Additional Resources:

NCBI RefSeq record:
NM_001278563.3
NBCI Gene record:
COL26A1 (136227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431802 TCGTTACGTTGTCTCATTATT pLKO_005 1819 3UTR 100% 15.000 21.000 N COL26A1 n/a
2 TRCN0000422079 TAATCCTAATACCCATCATTT pLKO_005 1759 3UTR 100% 13.200 18.480 N COL26A1 n/a
3 TRCN0000117312 CCGCCTACAGACAAAGACAAT pLKO.1 996 CDS 100% 4.950 6.930 N COL26A1 n/a
4 TRCN0000117314 GCCGCCTACAGACAAAGACAA pLKO.1 995 CDS 100% 4.950 6.930 N COL26A1 n/a
5 TRCN0000117313 CGTAAGTTACAGGACTCTGAT pLKO.1 434 CDS 100% 4.950 3.960 N COL26A1 n/a
6 TRCN0000429532 ACATGATTGGGATCCACGATC pLKO_005 1306 CDS 100% 4.050 3.240 N COL26A1 n/a
7 TRCN0000432354 TGACATGAGTGAGCGACTGAC pLKO_005 569 CDS 100% 4.050 2.835 N COL26A1 n/a
8 TRCN0000117316 GCAACTGTGATGAGGAATGCA pLKO.1 529 CDS 100% 3.000 2.100 N COL26A1 n/a
9 TRCN0000117315 GCCGACCTGGAATGAGGACTT pLKO.1 677 CDS 100% 1.350 0.945 N COL26A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.