Transcript: Human NM_001278615.1

Homo sapiens protocadherin 1 (PCDH1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PCDH1 (5097)
Length:
2925
CDS:
366..2411

Additional Resources:

NCBI RefSeq record:
NM_001278615.1
NBCI Gene record:
PCDH1 (5097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434207 GCCAATGCAGAAATCGAATAC pLKO_005 159 5UTR 100% 10.800 15.120 N PCDH1 n/a
2 TRCN0000055562 GCTTTGATCGAGAGCAACAAA pLKO.1 1243 CDS 100% 5.625 7.875 N PCDH1 n/a
3 TRCN0000423866 ACGTTGGTGTCACCATCAATG pLKO_005 1321 CDS 100% 10.800 7.560 N PCDH1 n/a
4 TRCN0000055560 GCTCTAATGCTGAGCTGGTTT pLKO.1 835 CDS 100% 4.950 3.465 N PCDH1 n/a
5 TRCN0000055558 GCTGAGCTGATCTACAGCATT pLKO.1 1476 CDS 100% 4.950 3.465 N PCDH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278615.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.