Transcript: Human NM_001278624.2

Homo sapiens nuclear transcription factor, X-box binding like 1 (NFXL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
NFXL1 (152518)
Length:
3880
CDS:
222..2957

Additional Resources:

NCBI RefSeq record:
NM_001278624.2
NBCI Gene record:
NFXL1 (152518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245353 GGGCTATGACATGCCTAATTT pLKO_005 688 CDS 100% 15.000 21.000 N NFXL1 n/a
2 TRCN0000245355 CAAGTATGTGAGCGTGAATTT pLKO_005 984 CDS 100% 13.200 18.480 N NFXL1 n/a
3 TRCN0000016137 CCTAGTAGGTACTATTGCTAT pLKO.1 906 CDS 100% 4.950 6.930 N NFXL1 n/a
4 TRCN0000245356 TACTAGAAAGGGCAGTATAAT pLKO_005 3125 3UTR 100% 15.000 10.500 N NFXL1 n/a
5 TRCN0000245352 GATGGAGATACACGTGAATTA pLKO_005 627 CDS 100% 13.200 9.240 N NFXL1 n/a
6 TRCN0000245354 GTATCCAGAAGTGGGCTAAAG pLKO_005 781 CDS 100% 10.800 7.560 N NFXL1 n/a
7 TRCN0000016134 CCATGTCAGAAATCAAAGTTT pLKO.1 1410 CDS 100% 5.625 3.938 N NFXL1 n/a
8 TRCN0000016136 CCTATTCCTATGGAATGTCTT pLKO.1 2127 CDS 100% 4.950 3.465 N NFXL1 n/a
9 TRCN0000016133 GCCAAGTATGTGAGCGTGAAT pLKO.1 982 CDS 100% 4.950 3.465 N NFXL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.