Transcript: Human NM_001278645.1

Homo sapiens NADH:ubiquinone oxidoreductase subunit B9 (NDUFB9), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-16
Taxon:
Homo sapiens (human)
Gene:
NDUFB9 (4715)
Length:
700
CDS:
219..590

Additional Resources:

NCBI RefSeq record:
NM_001278645.1
NBCI Gene record:
NDUFB9 (4715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244472 CAATGTATCCTGATTACTTTG pLKO_005 388 CDS 100% 10.800 15.120 N NDUFB9 n/a
2 TRCN0000028482 CCTCCTATGAGAGATACGATT pLKO.1 316 CDS 100% 4.950 6.930 N NDUFB9 n/a
3 TRCN0000244468 AGCTGGGAACGAGAGGTTAAG pLKO_005 444 CDS 100% 10.800 8.640 N NDUFB9 n/a
4 TRCN0000244469 AGCCCGGTTTGAAGAACATAA pLKO_005 185 5UTR 100% 13.200 9.240 N NDUFB9 n/a
5 TRCN0000028480 GAAGGCAATGTATCCTGATTA pLKO.1 383 CDS 100% 13.200 9.240 N NDUFB9 n/a
6 TRCN0000244471 TGCCCGAAAGGAAGGTGATTT pLKO_005 518 CDS 100% 13.200 9.240 N NDUFB9 n/a
7 TRCN0000028416 CCCGGTTTGAAGAACATAAGA pLKO.1 187 5UTR 100% 5.625 3.938 N NDUFB9 n/a
8 TRCN0000041559 CCGGTTTGAAGAACATAAGAA pLKO.1 188 5UTR 100% 5.625 3.938 N Ndufb9 n/a
9 TRCN0000308961 CCGGTTTGAAGAACATAAGAA pLKO_005 188 5UTR 100% 5.625 3.938 N Ndufb9 n/a
10 TRCN0000028479 CCTGCCCGAAAGGAAGGTGAT pLKO.1 516 CDS 100% 1.350 0.945 N NDUFB9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.