Transcript: Human NM_001280549.2

Homo sapiens paired box 5 (PAX5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PAX5 (5079)
Length:
8472
CDS:
238..1212

Additional Resources:

NCBI RefSeq record:
NM_001280549.2
NBCI Gene record:
PAX5 (5079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001280549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016059 CCCTCAGTATTCCTCGTACAA pLKO.1 1049 CDS 100% 4.950 6.930 N PAX5 n/a
2 TRCN0000016060 GCAGGTATTATGAGACAGGAA pLKO.1 446 CDS 100% 2.640 3.696 N PAX5 n/a
3 TRCN0000016058 CCGGTGATGTAGACAATAATT pLKO.1 2222 3UTR 100% 15.000 12.000 N PAX5 n/a
4 TRCN0000016061 CGCAAGAGAGACGAAGGTATT pLKO.1 826 CDS 100% 10.800 8.640 N PAX5 n/a
5 TRCN0000016062 GCAGCACTACTCAGACATCTT pLKO.1 966 CDS 100% 4.950 3.465 N PAX5 n/a
6 TRCN0000428804 GCTTCCAGTCACAGCATAGTG pLKO_005 694 CDS 100% 4.950 3.465 N Pax5 n/a
7 TRCN0000430197 TCGCTGAATATAAACGCCAAA pLKO_005 533 CDS 100% 4.050 2.835 N PAX5 n/a
8 TRCN0000432657 CTGACTATCCATCCATCATAA pLKO_005 1494 3UTR 100% 13.200 7.920 N PAX5 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7289 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001280549.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.