Transcript: Human NM_001281428.1

Homo sapiens dynein axonemal intermediate chain 1 (DNAI1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DNAI1 (27019)
Length:
2605
CDS:
255..2366

Additional Resources:

NCBI RefSeq record:
NM_001281428.1
NBCI Gene record:
DNAI1 (27019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417737 AGTTGACCGATGCGGAGTTAA pLKO_005 421 CDS 100% 13.200 18.480 N DNAI1 n/a
2 TRCN0000083438 CGCTTGAATACAGTACTCCTA pLKO.1 2393 3UTR 100% 2.640 3.696 N DNAI1 n/a
3 TRCN0000415032 AGCGGATGGTCAACCAGAATA pLKO_005 1126 CDS 100% 13.200 9.240 N DNAI1 n/a
4 TRCN0000083440 GCTTCAAAGAAGGCACATATA pLKO.1 508 CDS 100% 13.200 9.240 N DNAI1 n/a
5 TRCN0000420378 TGATGACATTGCTCAAGATTT pLKO_005 1151 CDS 100% 13.200 9.240 N DNAI1 n/a
6 TRCN0000083441 CCACAAAGAGATTGACTACAT pLKO.1 1778 CDS 100% 4.950 3.465 N DNAI1 n/a
7 TRCN0000083442 GCTGGTTCACATAGATGTCAT pLKO.1 1673 CDS 100% 4.950 3.465 N DNAI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.