Transcript: Mouse NM_001281527.1

Mus musculus predicted gene 7361 (Gm7361), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gm7361 (664837)
Length:
804
CDS:
1..804

Additional Resources:

NCBI RefSeq record:
NM_001281527.1
NBCI Gene record:
Gm7361 (664837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001281527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200832 GCTGGAGGAGAATCTTATAAA pLKO.1 465 CDS 100% 15.000 7.500 Y Speer4a n/a
2 TRCN0000246387 TGCTGGAGGAGAATCTTATAA pLKO_005 464 CDS 100% 15.000 7.500 Y Speer4a n/a
3 TRCN0000270308 CACAGGCAAACTCGACATTAT pLKO_005 307 CDS 100% 13.200 6.600 Y Gm10220 n/a
4 TRCN0000246389 CCACAGGCAAACTCGACATTA pLKO_005 306 CDS 100% 13.200 6.600 Y Speer4a n/a
5 TRCN0000176553 CCTCAGATGAATCTTCTTATA pLKO.1 761 CDS 100% 13.200 6.600 Y 5031410I06Rik n/a
6 TRCN0000284246 CTCACTACCGAGGAGACAAAT pLKO_005 229 CDS 100% 13.200 6.600 Y Gm10220 n/a
7 TRCN0000255101 GAGAAGGAGATCATGACATTT pLKO_005 346 CDS 100% 13.200 6.600 Y Speer4e n/a
8 TRCN0000255103 AGGCTGATTGGGCCATCATTC pLKO_005 527 CDS 100% 10.800 5.400 Y Speer4e n/a
9 TRCN0000284248 AGTTGAACCTGAGTGGTAAAG pLKO_005 563 CDS 100% 10.800 5.400 Y Gm10220 n/a
10 TRCN0000249994 TAAAGAAGAAGTTGGCGATAT pLKO_005 482 CDS 100% 10.800 5.400 Y Speer4b n/a
11 TRCN0000179250 GAGACAAATGAGCTGAGAGAT pLKO.1 241 CDS 100% 4.950 2.475 Y Gm9758 n/a
12 TRCN0000176051 GCAGTTTGAGAAGGAAGAGAA pLKO.1 186 CDS 100% 4.950 2.475 Y Speer4d n/a
13 TRCN0000191793 GAAATTAAAGGAGAAGGAGAT pLKO.1 336 CDS 100% 4.050 2.025 Y Speer4a n/a
14 TRCN0000270314 GAGAAGGAGATCATGACATAT pLKO_005 346 CDS 100% 13.200 6.600 Y Gm10220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.