Transcript: Mouse NM_001281978.1

Mus musculus inversin (Invs), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Invs (16348)
Length:
5900
CDS:
1445..3655

Additional Resources:

NCBI RefSeq record:
NM_001281978.1
NBCI Gene record:
Invs (16348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001281978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086438 CGCTTTACTATTTGCACCTAA pLKO.1 3718 3UTR 100% 4.950 6.930 N Invs n/a
2 TRCN0000331571 CGCTTTACTATTTGCACCTAA pLKO_005 3718 3UTR 100% 4.950 6.930 N Invs n/a
3 TRCN0000304456 ATGTGATTCAGACGCTTATTA pLKO_005 1677 CDS 100% 15.000 10.500 N Invs n/a
4 TRCN0000304454 ACCCAAACGTGCAGGATTATG pLKO_005 1809 CDS 100% 13.200 9.240 N Invs n/a
5 TRCN0000304455 CCTATGAAAGCTGCAACATAA pLKO_005 1081 5UTR 100% 13.200 9.240 N Invs n/a
6 TRCN0000086440 CCTAATCAGATGGAGAACAAT pLKO.1 2009 CDS 100% 5.625 3.938 N Invs n/a
7 TRCN0000301818 CCTAATCAGATGGAGAACAAT pLKO_005 2009 CDS 100% 5.625 3.938 N Invs n/a
8 TRCN0000086441 CGGAGGGTACATCAACTGTAT pLKO.1 1861 CDS 100% 4.950 3.465 N Invs n/a
9 TRCN0000086442 GCAGTCTATACATCTTGACAA pLKO.1 3562 CDS 100% 4.950 3.465 N Invs n/a
10 TRCN0000086439 GCCATTAAACTACTGCTAGAT pLKO.1 1976 CDS 100% 4.950 3.465 N Invs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.