Transcript: Mouse NM_001282000.1

Mus musculus RB transcriptional corepressor like 2 (Rbl2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rbl2 (19651)
Length:
4806
CDS:
120..3398

Additional Resources:

NCBI RefSeq record:
NM_001282000.1
NBCI Gene record:
Rbl2 (19651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374158 TTGCAGAAATGCTCTACTATA pLKO_005 1462 CDS 100% 13.200 18.480 N Rbl2 n/a
2 TRCN0000071276 CCCTATATTAGGAAACTGTTT pLKO.1 879 CDS 100% 4.950 3.960 N Rbl2 n/a
3 TRCN0000365867 CACTTCTGGAAACCCTATATT pLKO_005 867 CDS 100% 15.000 10.500 N Rbl2 n/a
4 TRCN0000365868 TGAATCCAGCAACTGATTAAA pLKO_005 3480 3UTR 100% 15.000 10.500 N Rbl2 n/a
5 TRCN0000071274 CGCTGACAGATTGAAAGAAAT pLKO.1 1358 CDS 100% 13.200 9.240 N Rbl2 n/a
6 TRCN0000071277 CCAGAACATCATGCGTTGTTA pLKO.1 2705 CDS 100% 5.625 3.938 N Rbl2 n/a
7 TRCN0000071275 GCTCTTCTTTAGAAAGGTTTA pLKO.1 2489 CDS 100% 10.800 6.480 N Rbl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.