Transcript: Mouse NM_001282095.1

Mus musculus tight junction protein 3 (Tjp3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tjp3 (27375)
Length:
2941
CDS:
128..2842

Additional Resources:

NCBI RefSeq record:
NM_001282095.1
NBCI Gene record:
Tjp3 (27375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091818 CGCTATGACATTTACAGGGTT pLKO.1 1169 CDS 100% 2.640 3.696 N Tjp3 n/a
2 TRCN0000091821 TGCAGGTGAATGGTATGCCAT pLKO.1 1371 CDS 100% 2.640 2.112 N Tjp3 n/a
3 TRCN0000091820 GAAGAGTTTGAGATTGCAGAA pLKO.1 2024 CDS 100% 4.050 2.835 N Tjp3 n/a
4 TRCN0000091822 GATGTGCTAATGAGGCCACTA pLKO.1 662 CDS 100% 4.050 2.835 N Tjp3 n/a
5 TRCN0000091819 GCAGGTGAATGGTATGCCATT pLKO.1 1372 CDS 100% 0.405 0.284 N Tjp3 n/a
6 TRCN0000444237 GGCAGTTCCTGGTGAACATTC pLKO_005 921 CDS 100% 10.800 6.480 N TJP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.