Transcript: Human NM_001282354.1

Homo sapiens integrin subunit beta 6 (ITGB6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ITGB6 (3694)
Length:
4408
CDS:
251..2332

Additional Resources:

NCBI RefSeq record:
NM_001282354.1
NBCI Gene record:
ITGB6 (3694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435605 TGACGACCTCAACACAATAAA pLKO_005 403 CDS 100% 15.000 10.500 N ITGB6 n/a
2 TRCN0000057706 GAAACATTTATGGGCCTTATT pLKO.1 1554 CDS 100% 13.200 9.240 N ITGB6 n/a
3 TRCN0000057707 GCCAACCCTTGCAGTAGTATT pLKO.1 545 CDS 100% 13.200 9.240 N ITGB6 n/a
4 TRCN0000416927 TACTTCTGTTTACCTACATTT pLKO_005 569 CDS 100% 13.200 9.240 N ITGB6 n/a
5 TRCN0000425690 CAACAATTGGACAACTCATTG pLKO_005 894 CDS 100% 10.800 7.560 N ITGB6 n/a
6 TRCN0000435985 GTGTCATTTCATGATCGTAAA pLKO_005 2165 CDS 100% 10.800 7.560 N ITGB6 n/a
7 TRCN0000057703 GCCTCCAAACATTCCCATGAT pLKO.1 2077 CDS 100% 4.950 3.465 N ITGB6 n/a
8 TRCN0000057704 CCATTGACAAATGATGCTGAA pLKO.1 608 CDS 100% 4.050 2.835 N ITGB6 n/a
9 TRCN0000057705 CCGAGAAGAATGTGTGGACAA pLKO.1 1888 CDS 100% 4.050 2.835 N ITGB6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.