Transcript: Human NM_001282356.2

Homo sapiens solute carrier family 26 member 7 (SLC26A7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLC26A7 (115111)
Length:
5305
CDS:
277..2247

Additional Resources:

NCBI RefSeq record:
NM_001282356.2
NBCI Gene record:
SLC26A7 (115111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044109 GCCTCAGCAATATAGTTTCTT pLKO.1 1319 CDS 100% 5.625 7.875 N SLC26A7 n/a
2 TRCN0000431607 GCTAATACAGTTCCGAGATTT pLKO_005 1536 CDS 100% 13.200 9.240 N SLC26A7 n/a
3 TRCN0000416007 TAGAAGTAGTTGGTCATATTC pLKO_005 1127 CDS 100% 13.200 9.240 N SLC26A7 n/a
4 TRCN0000044111 CCTTATAGTCATCTATGCAAT pLKO.1 1446 CDS 100% 4.950 3.465 N SLC26A7 n/a
5 TRCN0000044108 GCACCACATTACAATCTGAAA pLKO.1 388 CDS 100% 4.950 3.465 N SLC26A7 n/a
6 TRCN0000044112 GAGGTTTACATGGACTGTAAA pLKO.1 2050 CDS 100% 1.320 0.924 N SLC26A7 n/a
7 TRCN0000044110 CGACTTTGAAATGCAAAGGAT pLKO.1 690 CDS 100% 0.300 0.210 N SLC26A7 n/a
8 TRCN0000255416 TGGTGCCTCTCCAAGTATTAA pLKO_005 76 5UTR 100% 15.000 7.500 Y LRRC69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.