Transcript: Human NM_001282466.2

Homo sapiens WAP four-disulfide core domain 1 (WFDC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WFDC1 (58189)
Length:
1291
CDS:
95..757

Additional Resources:

NCBI RefSeq record:
NM_001282466.2
NBCI Gene record:
WFDC1 (58189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118194 CCTACGACACAAACTTTACAA pLKO.1 667 CDS 100% 5.625 7.875 N WFDC1 n/a
2 TRCN0000373867 CAAGGCTCAGCATCTTGATAT pLKO_005 1071 3UTR 100% 13.200 9.240 N WFDC1 n/a
3 TRCN0000118193 CCAGAAGGTGACTCAAAGAAT pLKO.1 695 CDS 100% 5.625 3.938 N WFDC1 n/a
4 TRCN0000118192 GCAAGAACATTCCTCTACTTT pLKO.1 776 3UTR 100% 5.625 3.938 N WFDC1 n/a
5 TRCN0000118195 TCTGCCAAGAATATCTGGAAA pLKO.1 182 CDS 100% 4.950 3.465 N WFDC1 n/a
6 TRCN0000118196 GACTCAAAGAATGTGGCAGAA pLKO.1 704 CDS 100% 4.050 2.835 N WFDC1 n/a
7 TRCN0000373868 ACAGAAGCACTTTCAGTAAAG pLKO_005 739 CDS 100% 10.800 6.480 N WFDC1 n/a
8 TRCN0000373866 TGCAGCTCCACGAGACCTTTA pLKO_005 997 3UTR 100% 10.800 6.480 N WFDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.