Transcript: Human NM_001282533.2

Homo sapiens leucine zipper tumor suppressor family member 3 (LZTS3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LZTS3 (9762)
Length:
4058
CDS:
338..2221

Additional Resources:

NCBI RefSeq record:
NM_001282533.2
NBCI Gene record:
LZTS3 (9762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156997 GCCTGTCGTACCCAAGAATTT pLKO.1 832 CDS 100% 13.200 18.480 N LZTS3 n/a
2 TRCN0000275458 AGTGGGTCGTCGTCATCTATG pLKO_005 1190 CDS 100% 10.800 15.120 N LZTS3 n/a
3 TRCN0000158022 CCCGGATAGAGGAAACTAAGT pLKO.1 1497 CDS 100% 4.950 6.930 N LZTS3 n/a
4 TRCN0000275459 CTGCACCAGGTTTGCTGAAAC pLKO_005 2650 3UTR 100% 10.800 7.560 N LZTS3 n/a
5 TRCN0000157948 CCAGCCTCTTTCTGCTTTCAT pLKO.1 3144 3UTR 100% 5.625 3.938 N LZTS3 n/a
6 TRCN0000157866 CCAGACCAAAGAGGTTCTCTA pLKO.1 2322 3UTR 100% 4.950 3.465 N LZTS3 n/a
7 TRCN0000157584 GTCGCAGAAGTTGAGTGAGAT pLKO.1 1588 CDS 100% 4.950 3.465 N LZTS3 n/a
8 TRCN0000157151 GAAGGTGATCGAGTACCAGAA pLKO.1 2029 CDS 100% 4.050 2.835 N LZTS3 n/a
9 TRCN0000154604 GAATTTCCACTCCATGCAGAA pLKO.1 847 CDS 100% 4.050 2.835 N LZTS3 n/a
10 TRCN0000155300 GATAGAGGAAACTAAGTGGGA pLKO.1 1501 CDS 100% 0.660 0.462 N LZTS3 n/a
11 TRCN0000157487 GCGCATTGAGTCCACAGAAAT pLKO.1 2197 CDS 100% 13.200 7.920 N LZTS3 n/a
12 TRCN0000275460 TGCCTCCACCAGCCACATTAA pLKO_005 1063 CDS 100% 13.200 7.920 N LZTS3 n/a
13 TRCN0000156745 GAAGGAGAAGGTGATCGAGTA pLKO.1 2023 CDS 100% 4.050 2.430 N LZTS3 n/a
14 TRCN0000156716 GCTCAGCACATCATCTTCCTA pLKO.1 3165 3UTR 100% 3.000 1.800 N LZTS3 n/a
15 TRCN0000156677 GCAGAAGTTGAGTGAGATCGT pLKO.1 1591 CDS 100% 2.640 1.584 N LZTS3 n/a
16 TRCN0000285377 GCAGAAGTTGAGTGAGATCGT pLKO_005 1591 CDS 100% 2.640 1.584 N LZTS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.