Transcript: Human NM_001282643.1

Homo sapiens sushi domain containing 1 (SUSD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
SUSD1 (64420)
Length:
2991
CDS:
63..2231

Additional Resources:

NCBI RefSeq record:
NM_001282643.1
NBCI Gene record:
SUSD1 (64420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425969 TGTACCCTACGACTGATTATA pLKO_005 1444 CDS 100% 15.000 21.000 N SUSD1 n/a
2 TRCN0000433786 AGCGGCACTCAGTGCAAATAA pLKO_005 1495 CDS 100% 15.000 12.000 N SUSD1 n/a
3 TRCN0000055469 CCTGTGTGAGATGGCAAATAA pLKO.1 991 CDS 100% 15.000 10.500 N SUSD1 n/a
4 TRCN0000418711 GAGTGATTACTGCATTATATT pLKO_005 2126 CDS 100% 15.000 10.500 N SUSD1 n/a
5 TRCN0000423516 ACTTTATGAAGGAGGTCATTG pLKO_005 2739 3UTR 100% 10.800 7.560 N SUSD1 n/a
6 TRCN0000424796 AGATCTGTATTTGCAACTATG pLKO_005 226 CDS 100% 10.800 7.560 N SUSD1 n/a
7 TRCN0000055472 GAATCACAAGTGAATGGAATA pLKO.1 2149 CDS 100% 10.800 7.560 N SUSD1 n/a
8 TRCN0000055470 GCTGAAGTTGATCTCTTAGAA pLKO.1 1230 CDS 100% 5.625 3.938 N SUSD1 n/a
9 TRCN0000055468 GCTGATATGGAGGAGATGTAT pLKO.1 1605 CDS 100% 5.625 3.938 N SUSD1 n/a
10 TRCN0000055471 GCACAGAAATAGACTGTGGTA pLKO.1 583 CDS 100% 0.264 0.158 N SUSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.