Transcript: Human NM_001282708.1

Homo sapiens exosome component 2 (EXOSC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
EXOSC2 (23404)
Length:
1956
CDS:
33..836

Additional Resources:

NCBI RefSeq record:
NM_001282708.1
NBCI Gene record:
EXOSC2 (23404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049843 CGCGACACTAAGAAACATCTA pLKO.1 90 CDS 100% 4.950 3.960 N EXOSC2 n/a
2 TRCN0000369628 GGGCTCCCATCCTGGAATAAT pLKO_005 1108 3UTR 100% 15.000 10.500 N EXOSC2 n/a
3 TRCN0000369627 TCCATTCCTATATCCTTTAAA pLKO_005 1240 3UTR 100% 15.000 10.500 N EXOSC2 n/a
4 TRCN0000049844 GACATCTTAAAGCCAGAAATA pLKO.1 762 CDS 100% 13.200 9.240 N EXOSC2 n/a
5 TRCN0000318911 GACATCTTAAAGCCAGAAATA pLKO_005 762 CDS 100% 13.200 9.240 N EXOSC2 n/a
6 TRCN0000049846 GAGAAGCTCATTGCATCTGTT pLKO.1 180 CDS 100% 4.950 3.465 N EXOSC2 n/a
7 TRCN0000318908 GAGAAGCTCATTGCATCTGTT pLKO_005 180 CDS 100% 4.950 3.465 N EXOSC2 n/a
8 TRCN0000049845 CCCACTTTCATGATTTGCCAT pLKO.1 505 CDS 100% 2.640 1.848 N EXOSC2 n/a
9 TRCN0000318910 CCCACTTTCATGATTTGCCAT pLKO_005 505 CDS 100% 2.640 1.848 N EXOSC2 n/a
10 TRCN0000049847 GCTGTATGATACCAGCATCCT pLKO.1 704 CDS 100% 2.640 1.848 N EXOSC2 n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 1329 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.