Transcript: Human NM_001282863.1

Homo sapiens R-spondin 2 (RSPO2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RSPO2 (340419)
Length:
2777
CDS:
450..989

Additional Resources:

NCBI RefSeq record:
NM_001282863.1
NBCI Gene record:
RSPO2 (340419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435381 ATCGCACATGTGGATTTAAAT pLKO_005 736 CDS 100% 15.000 10.500 N RSPO2 n/a
2 TRCN0000431718 CAGACAGAGCTAACCAATAAA pLKO_005 970 CDS 100% 15.000 10.500 N RSPO2 n/a
3 TRCN0000414548 GGACGGACTTGTGCCTATTTA pLKO_005 1293 3UTR 100% 15.000 10.500 N RSPO2 n/a
4 TRCN0000421619 GAAACCAGAACACGGCAAATT pLKO_005 765 CDS 100% 13.200 9.240 N RSPO2 n/a
5 TRCN0000116552 GCTGAGGATATGCTCTGGAAA pLKO.1 1477 3UTR 100% 4.950 3.465 N RSPO2 n/a
6 TRCN0000116555 CCATTGCTGAATCCAGGAGAT pLKO.1 823 CDS 100% 4.050 2.835 N RSPO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.