Transcript: Human NM_001282871.2

Homo sapiens Rh blood group D antigen (RHD), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
RHD (6007)
Length:
2830
CDS:
40..1521

Additional Resources:

NCBI RefSeq record:
NM_001282871.2
NBCI Gene record:
RHD (6007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082941 CATGATGCACATCTACGTGTT pLKO.1 543 CDS 100% 4.050 2.835 N RHD n/a
2 TRCN0000432344 ATCCAGTAAGCTAAGGTTAAT pLKO_005 1586 3UTR 100% 13.200 7.920 N RHD n/a
3 TRCN0000082940 GCCGTGTTCAACACCTACTAT pLKO.1 748 CDS 100% 5.625 3.375 N RHD n/a
4 TRCN0000438203 GCAACCTGAGGATGGTCATCA pLKO_005 491 CDS 100% 4.950 2.970 N RHD n/a
5 TRCN0000082939 CCACATGAACATGATGCACAT pLKO.1 534 CDS 100% 4.050 2.430 N RHD n/a
6 TRCN0000060059 GCTCTCATTCTCCTCTTCTAT pLKO.1 106 CDS 100% 5.625 2.813 Y RHCE n/a
7 TRCN0000082938 CCTGCATTTGTACGTGAGAAA pLKO.1 1371 CDS 100% 4.950 2.475 Y RHD n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2297 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2297 3UTR 100% 5.625 2.813 Y EID2B n/a
10 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 1839 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.