Transcript: Human NM_001284284.1

Homo sapiens VOPP1 WW domain binding protein (VOPP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
VOPP1 (81552)
Length:
2941
CDS:
190..681

Additional Resources:

NCBI RefSeq record:
NM_001284284.1
NBCI Gene record:
VOPP1 (81552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322750 CCGTACGAACAGGTAGTGAAG pLKO_005 652 CDS 100% 4.050 5.670 N VOPP1 n/a
2 TRCN0000142082 CGAAGGACTCTATCCAACCTA pLKO.1 249 CDS 100% 3.000 4.200 N VOPP1 n/a
3 TRCN0000142813 CATTGCTGGTATTTCGAAGGA pLKO.1 235 CDS 100% 2.640 2.112 N VOPP1 n/a
4 TRCN0000322691 ACTCTATCCAACCTATTATAT pLKO_005 255 CDS 100% 15.000 10.500 N VOPP1 n/a
5 TRCN0000322751 GGCTTTCCATGGAGTACAATA pLKO_005 828 3UTR 100% 13.200 9.240 N VOPP1 n/a
6 TRCN0000145551 CCAAACTGAGACATTGCATTT pLKO.1 1402 3UTR 100% 10.800 7.560 N VOPP1 n/a
7 TRCN0000322749 ATCGAGGAGCCAGCCTTCAAT pLKO_005 433 CDS 100% 5.625 3.938 N VOPP1 n/a
8 TRCN0000144471 CAAAGCACAATGTTCACTGTT pLKO.1 2349 3UTR 100% 4.950 3.465 N VOPP1 n/a
9 TRCN0000141541 CTGTGGTACTTCTGGTTCCTT pLKO.1 340 CDS 100% 3.000 2.100 N VOPP1 n/a
10 TRCN0000141351 CCTTCAATGTGTCCTACACCA pLKO.1 446 CDS 100% 2.640 1.848 N VOPP1 n/a
11 TRCN0000322748 TACAGAGGCTGTGGTACTTCT pLKO_005 332 CDS 100% 4.950 2.970 N VOPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.