Transcript: Human NM_001284292.2

Homo sapiens NUT midline carcinoma family member 1 (NUTM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
NUTM1 (256646)
Length:
4109
CDS:
383..3865

Additional Resources:

NCBI RefSeq record:
NM_001284292.2
NBCI Gene record:
NUTM1 (256646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284292.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136133 GAACCTGTCAACATACTAGAT pLKO.1 3161 CDS 100% 4.950 6.930 N NUTM1 n/a
2 TRCN0000135346 CCTGTCAACATACTAGATGTT pLKO.1 3164 CDS 100% 0.495 0.693 N NUTM1 n/a
3 TRCN0000135537 CCTTTGAAACTTGATCCTCTA pLKO.1 1403 CDS 100% 4.050 3.240 N NUTM1 n/a
4 TRCN0000137791 GCTTACCTCTTGGCCTCTAAA pLKO.1 3527 CDS 100% 13.200 9.240 N NUTM1 n/a
5 TRCN0000135085 CGAGAGAAACTTCTGTTAGTA pLKO.1 3420 CDS 100% 5.625 3.938 N NUTM1 n/a
6 TRCN0000135450 GCATCTAATGTGAAGACCATT pLKO.1 872 CDS 100% 4.950 3.465 N NUTM1 n/a
7 TRCN0000137534 CCACCAATGGAGAATCCCAAT pLKO.1 3942 3UTR 100% 4.050 2.835 N NUTM1 n/a
8 TRCN0000137223 GATTCAGAACACACAGCTGAT pLKO.1 1351 CDS 100% 4.050 2.835 N NUTM1 n/a
9 TRCN0000136548 CCAATGGAGAATCCCAATGTT pLKO.1 3945 3UTR 100% 5.625 3.375 N NUTM1 n/a
10 TRCN0000137266 GCAGAAAGGTTCATGGAGTTT pLKO.1 1313 CDS 100% 4.950 2.970 N NUTM1 n/a
11 TRCN0000135952 GAGGAGATGCAGATTCAGAAA pLKO.1 1340 CDS 100% 4.950 2.475 Y NUTM2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284292.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.